NEB Tm Calculator
The Melting Temperature (Tm) is a critical parameter in molecular biology, especially for designing PCR primers and hybridization probes. This calculator helps you determine the Tm of your oligonucleotide primers based on their sequence and reaction conditions, aiding in the optimization of annealing temperatures for specific and efficient reactions.
Only A, T, C, G characters will be used for calculation.
Typical PCR buffer contains 50-100 mM monovalent cations.
Typical PCR buffer contains 1.5-2.5 mM Mg2+.
Total concentration of all four dNTPs (e.g., 0.2 mM for each dNTP means 0.8 mM total).
Typical working primer concentration is 50-500 nM.
Understanding Melting Temperature (Tm)
The melting temperature (Tm) of a DNA oligonucleotide is the temperature at which half of the DNA strands are in a double-stranded (hybridized) state and half are in a single-stranded (denatured) state. For PCR and other hybridization-based techniques, the Tm is a critical parameter that dictates the optimal annealing temperature. An annealing temperature too high will prevent primers from binding, leading to no product. An annealing temperature too low can lead to non-specific binding and off-target amplification.
Factors Influencing Tm
- Primer Length: Longer primers generally have higher Tm values due to more base pairs contributing to stability.
- GC Content: Guanine (G) and Cytosine (C) bases form three hydrogen bonds, while Adenine (A) and Thymine (T) form two. Therefore, higher GC content leads to a more stable duplex and a higher Tm.
- Salt Concentration (Monovalent Cations): Cations like Na+ and K+ neutralize the negative charges on the DNA backbone, reducing electrostatic repulsion between strands and increasing duplex stability, thus raising Tm.
- Divalent Cation Concentration (Mg2+): Divalent cations like Mg2+ are even more effective at stabilizing DNA duplexes than monovalent cations. They are essential cofactors for DNA polymerases in PCR. However, they can also be chelated by dNTPs.
- dNTP Concentration: Deoxynucleotide triphosphates (dNTPs) chelate Mg2+ ions, effectively reducing the free Mg2+ concentration available to stabilize the DNA duplex. This can lower the effective Tm.
- Primer Concentration: Higher primer concentrations can slightly increase Tm, as there are more opportunities for primers to find and bind to their target.
How to Use This Calculator
- Enter Primer Sequence: Input your DNA primer sequence (5′ to 3′). The calculator will automatically ignore non-ATCG characters.
- Set Monovalent Cation Concentration: Enter the combined concentration of Na+ and K+ in your reaction buffer in millimolar (mM).
- Set Divalent Cation Concentration: Enter the concentration of Mg2+ in your reaction buffer in millimolar (mM).
- Set Total dNTP Concentration: Enter the total concentration of all four dNTPs (dATP, dCTP, dGTP, dTTP) in millimolar (mM). For example, if each dNTP is at 0.2 mM, the total is 0.8 mM.
- Set Primer Concentration: Enter the working concentration of your primer in nanomolar (nM).
- Click "Calculate Tm": The calculated melting temperature will be displayed.
Example Calculation
Primer Sequence: AGCTAGCTAGCTAGCTAGCT
Monovalent Cation Concentration: 50 mM
Divalent Cation Concentration: 1.5 mM
Total dNTP Concentration: 0.2 mM
Primer Concentration: 250 nM
Calculated Tm: Approximately 58.1 °C
This calculator uses a modified formula that accounts for primer length, GC content, and the concentrations of monovalent cations, divalent cations, and dNTPs. For very short primers (<14 bp), the simpler Wallace rule is applied. For longer primers, a salt-adjusted formula with a primer concentration heuristic is used. Please note that these are approximations, and experimental validation is always recommended.